Blogue Linux

1 mars 2018

Blogue Linux est un des très rares blogues francophones portant sur l’informatique.  Ce blogue s’intéresse surtout à l’open source et aux solutions logicielles sur Linux.  On y jase des diverses versions de Linux et des nouveautés du côté des logiciels et de l’OS.

Publicités

Simuler les charges d’un système

29 septembre 2017

Vous désirez observer comment vos applications ou votre système réagiront lors d’un accroissement des charges sur le CPU, la mémoire ou vos disques?  Rien de plus facile avec Linux puisque tout ce dont vous avez besoin est à portée de main!

Un article utile à toujours avoir en mémoire pour simuler des conditions d’utilisation réelles sans trop se casser la tête!


Julia Evans

6 décembre 2016

If you’re using Linux or just want to learn about it, you should definitely have a look at this.

Lots of stuff on Julia’s website.  You can also follow her on Twitter, @b0rk.

It nicely done, informative, cool, interesting, fresh and concise.

And she’s from Montreal too! :)


BioSmalltalk

13 janvier 2013

La toute dernière version de BioSmalltalk est disponible ici !

Que ce soit pour Pharo ou Squeak, sur Windows ou sur Linux.  Pour ceux qui désirent un outil flexible, compréhensible, extensible et configurable  pour faire de la bio-informatique, c’est un must!

Des clients/API pour les bases de données BLAST, BioEntrez et FASTA (entre autres) sont déjà inclus dans BioSmalltalk.  Plusieurs  utilitaires pour parser des séquences génomiques, des fichiers CSV ou des fichiers XML sont également inclus.

Bref,  vous n’avez plus l’excuse de devoir recourir à des modules en Perl pour faire de la bio-informatique.  Qui plus est, Smalltalk est tellement plus cool!

Par ailleurs, le blogue  (en anglais) contient plusieurs exemples pratiques de l’utilisation de BioSmalltalk!

Amusez-vous!

ATGCAATTAAAGAAACTGATGTATTAGCATTATTTCGTATTACTCCACAACCAGGTGTAGAT