BioSmalltalk

13 janvier 2013

La toute dernière version de BioSmalltalk est disponible ici !

Que ce soit pour Pharo ou Squeak, sur Windows ou sur Linux.  Pour ceux qui désirent un outil flexible, compréhensible, extensible et configurable  pour faire de la bio-informatique, c’est un must!

Des clients/API pour les bases de données BLAST, BioEntrez et FASTA (entre autres) sont déjà inclus dans BioSmalltalk.  Plusieurs  utilitaires pour parser des séquences génomiques, des fichiers CSV ou des fichiers XML sont également inclus.

Bref,  vous n’avez plus l’excuse de devoir recourir à des modules en Perl pour faire de la bio-informatique.  Qui plus est, Smalltalk est tellement plus cool!

Par ailleurs, le blogue  (en anglais) contient plusieurs exemples pratiques de l’utilisation de BioSmalltalk!

Amusez-vous!

ATGCAATTAAAGAAACTGATGTATTAGCATTATTTCGTATTACTCCACAACCAGGTGTAGAT