BioSmalltalk (2)

6 avril 2015

Le site web de BioSmalltalk s’est refait une beauté : allez-y voir!  En plus, ça vous donnera la chance d’essayer leur application!


Un chromosome

24 décembre 2014

Télécharger les données d’un chromosome humain de manière facile?  BioSmalltalk (dont j’ai précédemment parlé ici) vous le permet dorénavant en une seule ligne de code!

Plus de détails ici!


Bio-informatique

20 juillet 2013

Je vous parlais, en début d’année, de BioSmalltalk (une librairie d’outils pour la bio-informatique écrite en Smalltalk disponible sur Pharo et Squeak).

Sachez que les auteurs (Hernán F. Morales et Guillermo Giovambattista) publieront un article (en anglais) dans le Bioinformatics Journal (de la prestigieuse Université d’Oxford).  Le sysnopsis de cet article est disponible ici.

Sur la même thématique, il se passe de belles choses à l’Université de Montréal en génomique et en épidémiologie au laboratoire de recherche Philip Awadalla pour le projet CARTaGENE.  Vous trouverez ici un article expliquant quels ont été les motifs qui ont poussé le laboratoire de recherche à utiliser MySQL et à préférer le moteur de stockage TokuDB à MyISAM quand est venu le temps de traiter des milliards de mutations dans leur base de données de façon performante.

 


BioSmalltalk

13 janvier 2013

La toute dernière version de BioSmalltalk est disponible ici !

Que ce soit pour Pharo ou Squeak, sur Windows ou sur Linux.  Pour ceux qui désirent un outil flexible, compréhensible, extensible et configurable  pour faire de la bio-informatique, c’est un must!

Des clients/API pour les bases de données BLAST, BioEntrez et FASTA (entre autres) sont déjà inclus dans BioSmalltalk.  Plusieurs  utilitaires pour parser des séquences génomiques, des fichiers CSV ou des fichiers XML sont également inclus.

Bref,  vous n’avez plus l’excuse de devoir recourir à des modules en Perl pour faire de la bio-informatique.  Qui plus est, Smalltalk est tellement plus cool!

Par ailleurs, le blogue  (en anglais) contient plusieurs exemples pratiques de l’utilisation de BioSmalltalk!

Amusez-vous!

ATGCAATTAAAGAAACTGATGTATTAGCATTATTTCGTATTACTCCACAACCAGGTGTAGAT