BioSmalltalk (2)

6 avril 2015

Le site web de BioSmalltalk s’est refait une beauté : allez-y voir!  En plus, ça vous donnera la chance d’essayer leur application!

Publicités

Smalltalk en vrac (14)

22 mars 2015

Smalltalk

Smalltalk sur un Raspberry Pi : les options.

Très intéressant article sur Smalltalk intitulé You Probably Don’t Know What a Computer Is.

Smalltalk : le langage de programmation le plus efficace et productif.

Les nombreux podcasts du très regretté James Robertson ont déménagé.

BioSmalltalk est maintenant sur GitHub.

Smalltalk Digest, édition de mars 2015.

Camp Smalltalk à Portland en Orégon en août?  Si ça vous intéresse, les détails ici.

Pharo

Pharo Sprints : à l’INRIA à Lille, le 3 avril.

Components, Agents and Robots (CAR) : un nouveau vidéo ici et un autre ici.

Google API Registry : maintenant offert pour Pharo!

Viva : un framework de base pour l’animation.

Mongo Spotter : pour consulter ou naviguer dans une BD Mongo.

Le précieux travail de Nicolas Cellier en ce qui a trait à l’aspect numérique/mathématique de Pharo a maintenant son propre package : ExtendedNumberParser.

Consulter une base de données Mongo avec GT Tools expliqué ici.

Assessment for Business Processes (A4BP) permet de visualiser les données BPM de format BPEL et BPMN.  Le projet a également une page Facebook.

GemStone

Comment sérialiser des graphes immenses avec SIXX.

 


Smalltalk en vrac (11)

24 février 2015

Pharo

PharoCloud offre maintenant une solution Pharo+MongoDB.

PhyloclassTalk est un outil d’analyse phylogénétique et bioinformatique.  Un vidéo montrant le GenBank Browser et le PhyloclassTalk Classifier et un autre montrant le Blast Query Builder.  Pour plus d’informations sur la biogénétique, il y a BioSmalltalk.

Présentation sur les slots dans Pharo 4.0.

Comment arrêter une image à partir d’une notification du système d’exploitation.

Présentation du Prague Lambda Meetup de janvier 2015.

MathsOntologie est un outil aidant à la résolution de problèmes en mathématiques.  Le manuel de référence est ici.

PlagueDoctor gère vos fenêtres inutilisées automatiquement!  Une description de l’utilitaire ici.

Squeak

Kyma est un langage de programmation avancé pour les sons et la musique.  Développé par Symbolic Sound, la version 7 est maintenant disponible et en vedette dans ce court vidéo.  Vous trouverez facilement sur Youtube ou sur le site de Symbolic Sound plus de vidéos, plus d’exemples, de tutoriels ou de pièces de musique composées avec Kyma.

 


Un chromosome

24 décembre 2014

Télécharger les données d’un chromosome humain de manière facile?  BioSmalltalk (dont j’ai précédemment parlé ici) vous le permet dorénavant en une seule ligne de code!

Plus de détails ici!


Bio-informatique

20 juillet 2013

Je vous parlais, en début d’année, de BioSmalltalk (une librairie d’outils pour la bio-informatique écrite en Smalltalk disponible sur Pharo et Squeak).

Sachez que les auteurs (Hernán F. Morales et Guillermo Giovambattista) publieront un article (en anglais) dans le Bioinformatics Journal (de la prestigieuse Université d’Oxford).  Le sysnopsis de cet article est disponible ici.

Sur la même thématique, il se passe de belles choses à l’Université de Montréal en génomique et en épidémiologie au laboratoire de recherche Philip Awadalla pour le projet CARTaGENE.  Vous trouverez ici un article expliquant quels ont été les motifs qui ont poussé le laboratoire de recherche à utiliser MySQL et à préférer le moteur de stockage TokuDB à MyISAM quand est venu le temps de traiter des milliards de mutations dans leur base de données de façon performante.

 


BioSmalltalk

13 janvier 2013

La toute dernière version de BioSmalltalk est disponible ici !

Que ce soit pour Pharo ou Squeak, sur Windows ou sur Linux.  Pour ceux qui désirent un outil flexible, compréhensible, extensible et configurable  pour faire de la bio-informatique, c’est un must!

Des clients/API pour les bases de données BLAST, BioEntrez et FASTA (entre autres) sont déjà inclus dans BioSmalltalk.  Plusieurs  utilitaires pour parser des séquences génomiques, des fichiers CSV ou des fichiers XML sont également inclus.

Bref,  vous n’avez plus l’excuse de devoir recourir à des modules en Perl pour faire de la bio-informatique.  Qui plus est, Smalltalk est tellement plus cool!

Par ailleurs, le blogue  (en anglais) contient plusieurs exemples pratiques de l’utilisation de BioSmalltalk!

Amusez-vous!

ATGCAATTAAAGAAACTGATGTATTAGCATTATTTCGTATTACTCCACAACCAGGTGTAGAT