Smalltalk en vrac (11)

24 février 2015

Pharo

PharoCloud offre maintenant une solution Pharo+MongoDB.

PhyloclassTalk est un outil d’analyse phylogénétique et bioinformatique.  Un vidéo montrant le GenBank Browser et le PhyloclassTalk Classifier et un autre montrant le Blast Query Builder.  Pour plus d’informations sur la biogénétique, il y a BioSmalltalk.

Présentation sur les slots dans Pharo 4.0.

Comment arrêter une image à partir d’une notification du système d’exploitation.

Présentation du Prague Lambda Meetup de janvier 2015.

MathsOntologie est un outil aidant à la résolution de problèmes en mathématiques.  Le manuel de référence est ici.

PlagueDoctor gère vos fenêtres inutilisées automatiquement!  Une description de l’utilitaire ici.

Squeak

Kyma est un langage de programmation avancé pour les sons et la musique.  Développé par Symbolic Sound, la version 7 est maintenant disponible et en vedette dans ce court vidéo.  Vous trouverez facilement sur Youtube ou sur le site de Symbolic Sound plus de vidéos, plus d’exemples, de tutoriels ou de pièces de musique composées avec Kyma.

 


BioSmalltalk

13 janvier 2013

La toute dernière version de BioSmalltalk est disponible ici !

Que ce soit pour Pharo ou Squeak, sur Windows ou sur Linux.  Pour ceux qui désirent un outil flexible, compréhensible, extensible et configurable  pour faire de la bio-informatique, c’est un must!

Des clients/API pour les bases de données BLAST, BioEntrez et FASTA (entre autres) sont déjà inclus dans BioSmalltalk.  Plusieurs  utilitaires pour parser des séquences génomiques, des fichiers CSV ou des fichiers XML sont également inclus.

Bref,  vous n’avez plus l’excuse de devoir recourir à des modules en Perl pour faire de la bio-informatique.  Qui plus est, Smalltalk est tellement plus cool!

Par ailleurs, le blogue  (en anglais) contient plusieurs exemples pratiques de l’utilisation de BioSmalltalk!

Amusez-vous!

ATGCAATTAAAGAAACTGATGTATTAGCATTATTTCGTATTACTCCACAACCAGGTGTAGAT