Count occurrences of a string using MySQL

This was originally posted in French here.

There’s no string function in MySQL (and many other databases!) to help you find the number of occurrences of a string within another string.  For example, how many times does « abc »  appear in « abcbcbabcbacbcabcababcabacb » ?

I was asked this question on IRC a long time ago. Some poor soul was trying to find a particular subsequence in a genomic string (for instance « TAT ») in the following sequence :

ATTGGTGGGCTCTACTAAGATATCAACGGGACTTCGGAGCGTGCCGCACTATTT

Obviously, you can use your favorite programming language and do this kind of search programmatically but is there a way to do it in SQL?

Luckily, the answer is yes!  The solution is simple and looks like this:

SELECT FLOOR(( LENGTH(source) - LENGTH(REPLACE(source, target, '')) ) / (LENGTH(target))) as occ

To come back to our example, « source » being the genomic sequence and « target » being « TAT », you’d have :

SELECT FLOOR(( LENGTH('ATTGGTGGGCTCTACTAAGATATCAACGGGACTTCGGAGCGTGCCGCACTATTT') - LENGTH(REPLACE('ATTGGTGGGCTCTACTAAGATATCAACGGGACTTCGGAGCGTGCCGCACTATTT', 'TAT', '')) ) / (LENGTH('TAT'))) as occ

Here’s the answer!

Fortunately, in life there are way more many solutions than problems!  And sometimes, long SQL queries!

P.S.  This new post will probably interest you a lot!

Update (2019-03-07)

Save

Save

Save

Save

Save

Publicités

Répondre

Entrez vos coordonnées ci-dessous ou cliquez sur une icône pour vous connecter:

Logo WordPress.com

Vous commentez à l'aide de votre compte WordPress.com. Déconnexion /  Changer )

Photo Google

Vous commentez à l'aide de votre compte Google. Déconnexion /  Changer )

Image Twitter

Vous commentez à l'aide de votre compte Twitter. Déconnexion /  Changer )

Photo Facebook

Vous commentez à l'aide de votre compte Facebook. Déconnexion /  Changer )

Connexion à %s

Ce site utilise Akismet pour réduire les indésirables. En savoir plus sur la façon dont les données de vos commentaires sont traitées.